Quality Control Metrics¶
In this document, we will discuss the built-in quality control metrics available from the PHG. Metrics accompany several steps of building and using the PHG, and many can be run as either standalone commands or as part of a related command.
AnchorWave dot plots¶
Dot plots
generated from the align-assemblies step
are a visual representation of the alignment between two assemblies.
They are useful for identifying large-scale structural
differences between assemblies, such as
inversions,
translocations,
and large deletions.
There are three methods to produce AnchorWave dot plots:
1. As part of the align-assemblies command:
./phg align-assemblies \
--gff data/anchors.gff \
--reference-file output/updated_assemblies/Ref.fa \
--assemblies data/assemblies_list.txt \
--total-threads 20 \
--in-parallel 2 \
-o output/alignment_files
The align-assemblies command runs code to create the dot plots
from AnchorWave's .anchorspro files. For each .anchorspro
file that is generated, a genome-wide dot plot image is created
and stored in the same location where .maf and .anchorspro
files are placed (-o parameter directory). Each image that is
generated will have the assembly name found in the --assemblies
parameter followed by the suffix, _dotplot.svg.
* For example, if your assemblies list file (in my case, this
would be assemblies_list.txt) has the following assemblies
to align:
Note
As of PHGv2 version 2.2.74.123, the plots generated with the
align-assemblies command are part of the default output and
is not optional.
2. As a standalone command:
The create-anchorwave-dotplot command creates a dot plot from
a user provided .anchorspro file generated from AnchorWave.
Users may use the output from either the align-assemblies
command, or from any user run AnchorWave alignment as the
--input-file parameter to create-anchorwave-dotplot.
Output from create-anchorwave-dotplot is written to the file
specified by the --output-file parameter. Users may specify
output files with extension of .svg or .png and the
appropriate file type will be generated.
3. Using rPHG2:
For more "granular" inspection of our alignment data, we can also use
the complimentary R package, rPHG2.
Check out the "Load and visualize PHG metrics"
section for more information.
VCF metrics¶
Once the gVCF and hVCF files for the TileDB instances have been created, we can produce a table summarizing metrics related to the assemblies used to produce them. These metrics are useful for identifying low-quality assemblies which you may wish to exclude from the PHG, or detecting problems with the assembly alignments.
There are three methods to produce or visualize VCF metrics:
1. As part of create-maf-vcf:
phg create-maf-vcf \
--db-path vcf_dbs \
--bed output/ref_ranges.bed \
--reference-file output/updated_assemblies/Ref.fa \
--maf-dir output/alignment_files \
-o output/vcf_files \
--metrics-file output/vcf_files/VCFMetrics.tsv \
--skip-metrics
By default, create-maf-vcf will write the VCF metrics table to the
same output directory as the VCF files (set with flag -o) and will
name the file VCFMetrics.tsv. The optional flag --metrics-file
can be used to change the destination of the table.
If VCF metrics are not desired, the --skip-metrics flag can be used
to skip calculating and writing the metrics table altogether.
Generally, we recommend reviewing the built-in QC metrics at each
step of building the PHG, so the default behavior is to calculate
metrics.
2. As a standalone command:
The calc-vcf-metrics command creates the VCF metrics table from a
directory of existing gVCF and hVCF files. It has two required
parameters:
* --vcf-dir - The path to the directory containing assembly VCF
files. gVCF (.g.vcf) files are required, but the
corresponding hVCF files are optional.
* --output - The name for the output metrics table
Note
calc-vcf-metrics is not a general-purpose tool for VCF files.
It was designed specifically for the files produced by
create-maf-vcf, which are single-sample, haploid gVCFs and hVCFs.
Metrics may not be accurate for VCF files that do not fit this
format.
3. Visualize gVCF metrics:
For more "granular" inspection of our gVCF data, we can also use
the complimentary R package, rPHG2.
Check out the "Load and visualize PHG metrics"
section for more information.
Output¶
For each gVCF file in the input directory, both chromosome-level and assembly-level statistics are calculated, and each has its own row in the table. The columns are as follows:
| Column | Description |
|---|---|
taxa |
The sample name in the gVCF file |
chrom |
The reference chromosome name. For assembly-level statistics this value is ALL |
refLength |
The length of the reference sequence |
numSNPs |
The number of SNP records in the gVCF file for the given chromosome |
numIns |
The number of insertion records in the gVCF file |
numDel |
The number of deletion records in the gVCF file |
numNs |
The number of N's/ambiguous bases in the assembly alignment |
numBasesInserted |
The number of bases inserted relative to the reference sequence |
numBasesDeleted |
The number of bases deleted relative to the reference sequence |
percentIdentityWithRef |
The proportion of bases relative to refLength that are the same base as the reference base |
percentMappedToRef |
The proportion of bases relative to refLength that are present in a gVCF record |
meanInsertionSize |
The mean size of insertion records |
medianInsertionSize |
The median size of insertion records |
largestInsertion |
The size of the largest insertion |
meanDeletionSize |
The mean size of deletion records |
medianDeletionSize |
The median size of deletion records |
largestDeletion |
The size of the largest deletion |
refRangesWithHaplotype |
The number of reference ranges with a non-missing haplotype in the hVCF file |
haplotypesIdenticalToRef |
The number of haplotypes identical to a reference haplotype in the hVCF file |
The last two columns, refRangesWithHaplotype and
haplotypesIdenticalToRef require hVCF files to calculate, and are
omitted if no hVCF files are present in the given directory. See the
hVCF specification documentation for more details about the hVCF
format.
Terminology disambiguation¶
percentIdentityWithRefis roughly equivalent to the percentage of bases contained in gVCF reference blocks with non-missing genotypes. It also includes the padding base of each indel record if that base is the same as the referencepercentMappedToRefincludes reference blocks, SNP records, and indel records. It is equivalent to the percentage of the reference covered by alignment blocks in the AnchorWave MAF files used to create the VCF filesrefRangesWithHaplotypeIn general, most assemblies will produce haplotypes at most reference ranges. However, large deletions may span an entire reference range or more, resulting in a missing range. A large number of missing ranges may indicate a problem with the assembly or the alignment.
Imputation metrics¶
Calculate imputation metrics for an hvcf file created by the Imputation pipeline
Command - imputation-metrics
Example
phg imputation-metrics \
--sample-hvcf my/parent/hvcf/from/create-maf-vcf \
--imputation-hvcf my/imputation/h.vcf \
--bed-file path/to/ranges.bed \
--read-mapping-files my/readMappingList.txt \
--output-file output/imputation_metrics.txt
Parameters
| Parameter name | Description | Default value | Required? |
|---|---|---|---|
--sample-hvcf |
Path to hvcf for the sample expected to be selected most often. | "" |
|
--imputation-hvcf |
Path to hvcf created from imputation pipeline. | "" |
|
--bed-file |
Path to bed file created in create-ranges. | "" |
|
--read-mapping-files |
Path to a file that contains a list of read-mapping files, one per line, full path names. | "" |
|
--output-file |
Path to a file where metrics will be printed. | "" |
|
| `--chrom' | Comma-separated list of contigs to include in output (optional) |
The imputation-metrics command calculates metrics for a given h.vcf file created as the output of find-paths.
It requires input that is not available to the find-paths command, so must be run separately from
that command.
The intent of this command is to provide a way to evaluate the quality of the imputation process. The metrics allow the user to see the path the imputation has taken, where it has diverged from the parent (sample) haplotype, and shows the read counts from the read mappings files that support each transition. The output is a tab-delimited file with data arranged in reference range order that can be opened in a spreadsheet program for further analysis.
Read mapping metrics¶
Return QC metrics for read mappings¶
Note
Need clarification!
Using FASTQ files as an input, this command creates a tab-delimited table reporting each k-mer generated from the FASTQ files and how well they map to haplotypes in the PHG database.
Command - qc-read-mapping
Example
phg qc-read-mapping \
--hvcf-dir path/to/hvcf_directory \
--output-dir path/to/output_directory \
--read-files reads1.fastq,reads2.fastq \
--kmer-index path/to/kmerIndex.txt \
--num-reads 20
Parameters
| Parameter name | Description | Default value | Required? |
|---|---|---|---|
--hvcf-dir |
Directory containing hVCF files used to build the HaplotypeGraph. | "" |
|
--output-dir |
Output folder for the read mapping results. | "" |
|
--read-files |
Comma separated list of FASTQ read files to map. | "" |
|
--kmer-index |
K-mer index file created by build-kmer-index. If not provided, defaults to <hvcfDir>/kmerIndex.txt. |
<hvcfDir>/kmerIndex.txt |
|
--num-reads |
Number of reads to process. This value controls how many reads are processed from each file. | 20 |
Example output
Kmer Hash1 Hash2 RefRanges Hapids
ACGTACGTACGTACGTACGTACGTACGTACGT d41d8cd98f00b204e9800998ecf8427e 0cc175b9c0f1b6a831c399e269772661 chr1:1000-2000,chr2:3000-4000 {0=[B73, Ki11]}
TGCACTGATGCACTGATGCACTGATGCACTGA 900150983cd24fb0d6963f7d28e17f72 f96b697d7cb7938d525a2f31aaf161d0 None {}
Kmer: A 32-nucleotide sequence extracted from the read.Hash1/Hash2: MD5 checksum–like hash values computed for the k-mer.RefRanges: A comma-separated list of reference ranges (formatted ascontig:start-end) where the k-mer was found.Hapids: A mapping from reference range IDs to the corresponding haplotype IDs that were matched.
Return QC metrics for read mapping counts¶
Using a read mapping file as input, this command will generate a tab-delimited report of QC metrics of read mapping counts for a given sample ID found the PHG DB.
Command - read-mapping-count-qc
Example
phg read-mapping-count-qc \
--hvcf-dir path/to/hvcf_directory \
--read-mapping-file path/to/read_mapping.txt \
--target-sample-name LineA \
--output-dir path/to/output_directory
Parameters
| Parameter name | Description | Default value | Required? |
|---|---|---|---|
--hvcf-dir |
Directory with Haplotype VCF files. | "" |
|
--read-mapping-file |
Read mapping file containing the mapping data. | "" |
|
--target-sample-name |
Target sample name for which counts will be computed. | "" |
|
--output-dir |
Output directory for writing the count QC results. | "" |
Example output
refRange LineA_HapID LineA_HapCount HighestAltCount Difference OtherHapCounts
1:1-1000 12f0cec9102e84a161866e37072443b7 853 0 853 0_4fc7b8af32ddd74e07cb49d147ef1938, 0_546d1839623a5b0ea98bbff9a8a320e2
1:1001-5500 3149b3144f93134eb29661bade697fc6 4378 70 4308 70_8967fabf10e55d881caa6fe192e7d4ca, 0_57705b1e2541c7634ea59a48fc52026f
1:5501-6500 1b568197f6f329ec5b71f66e49a732fb 855 47 808 47_05efe15d97db33185b64821791b01b0f, 0_d896e9cc56e74f39fd3f3c665191d727
1:6501-11000 369464a8743d2e40ad83d1375c196bdd 4355 101 4254 101_8f7de1a693aa15fb8fb7b85e7a8b5e95, 24_66465399052d8ebe48b06329c60fee03
refRange: The reference range.LineA_HapID: The haplotype ID corresponding to the target sample (e.g.,--target-sample-name LineA).LineA_HapCount: The count of reads mapping to the target haplotype.HighestAltCount: The highest count among non-target haplotypes.Difference: The difference between the target haplotype count and the highest alternative count.OtherHapCounts: A comma-separated list of counts and haplotype IDs for all other haplotypes in the reference range.
Return a read mapping count table¶
Using a directory of read mapping files as input, this command produces one tab-delimited count table per file. Each table reports, for every reference range in the PHG, the total number of reads attributed to each sample in the graph.
Command - mapping-count-table-qc
Example
phg mapping-count-table-qc \
--hvcf-dir path/to/hvcf_directory \
--read-mapping-dir path/to/read_mapping_directory \
--output-dir path/to/output_directory
Parameters
| Parameter name | Description | Default value | Required? |
|---|---|---|---|
--hvcf-dir |
Directory with Haplotype VCF files. | "" |
|
--read-mapping-dir |
Directory containing read mapping files. All files ending in _readMapping.txt will be processed. |
"" |
|
--output-dir |
Output directory for the count tables. | "" |
For each *_readMapping.txt file found in --read-mapping-dir, a
corresponding *_mappingCounts.txt file is written to --output-dir.
For example, LineA_1_readMapping.txt produces
LineA_1_mappingCounts.txt.
Each read mapping entry contains a set of one or more hapIds that a group of reads mapped to. The command resolves which reference range that hapId set belongs to, then credits the read count to every sample in the graph that carries one of those hapIds at that range. HapId sets that span more than one reference range cannot be unambiguously attributed and are skipped with a warning.
Example output
RefRange LineA:0 LineB:0 Ref:0
1:1-1000 853 0 0
1:1001-5500 4378 4378 4378
1:5501-6500 902 902 0
1:6501-11000 4396 0 0
RefRange: The reference range incontig:start-endformat.<SampleName>:<gameteId>columns: One column per sample gamete in the graph, labeled assampleName:gameteId. Each value is the total number of reads attributed to that sample at the given reference range. Ranges where no reads mapped for a given sample are reported as0.